ConBind 2018-04-19T12:21:52+00:00

Eukaryotic gene expression is regulated by transcription factors (TFs) binding to promoter as well as distal enhancers. TFs recognize short, but specific binding sites (TFBSs) that are located within the promoter and enhancer regions. Functionally relevant TFBSs are often highly conserved during evolution leaving a strong phylogenetic signal. ConBind is a novel phylogenetic fooprinting tool that improves the identification of conserved TFBSs by improving the alignment accuracy of TFBS families within orthologous DNA sequences.

For instance, in the alignment below Motif A shows a strong sequence similarity while the sequence similarity of Motif B is residual.

CACTTCCTGCAAAAGATAGGG
GTCTTGAGGTCAGAGATAGTC
–––GGAAGACTAAAGATAGTC
AGGTTCCC–––AAAGATAGTC
TTTCATCTTGACA-GAAGGTC
CAGATCCA–––GACGATA–––
AAGATCCTGCCAAAGATAGTC

Normally multiple sequence alignment implementations are optimized to align the maximum number of identical nucleotides. Therefore they can detect motifs like Motif A. ConBind has been optimized to detect both type of motifs, even if the mutual sequence similarity is residual, like in the case of Motif B. Furthermore, ConBind streamlines and facilitates the phylogenetic footprinting workflow by automatically gathering all necessary input for the alignment. Given the  chromosmal position, ConBind automatically fetches the reference sequence from UCSC and gathers all the orthologous sequences that better match the reference. After a few minutes, it is possible to consult the alignments on line or export them in XML, FASTA, MSF, HTML, and Jalview format.

The use of ConBind for commercial purposes requires a license. For more information contact us at .

The ConBind method has been published as:

S.H. Lelieveld*, J. Schütte*, M. Dijkstra, P. Bawono, S.J. Kinston, B. Göttgens, J. Heringa, and N. Bonzanni
ConBind: motif-aware cross-species alignment for the identification of functional transcription factor binding sites.
Nucleic Acids Research (2015): gkv1518.